circad | circRNAs associated with diseases

mmu_circRNA_006173
Gene	n/a	Organism	Mouse
Genome Locus	n/a	Build	n/a
Disease	Alzheimer's disease	ICD-10	Alzheimer's disease (G30)
DBLink	Link to database	PMID	29448241
Experimental Method
Sample Type	Hippocampal Tissues	Comparison	hippocampal tissues of SAMP8 and SAMR1
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCTACCAGGCTCTCCTCCCA Reverse TCCAGGCACGTGCTCTGAG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Huang, JL, Qin, MC, Zhou, Y, Xu, ZH, Yang, SM, Zhang, F, Zhong, J, Liang, MK, Chen, B, Zhang, WY, Wu, DP, Zhong, ZG (2018). Comprehensive analysis of differentially expressed profiles of Alzheimer's disease associated circular RNAs in an Alzheimer's disease mouse model. Aging (Albany NY), 10, 2:253-265.